Explorar el Código

Another f# problem done

master
Lachlan Jacob hace 6 años
padre
commit
75f9d49fbc

+ 26
- 0
exercism/fsharp/nucleotide-count/NucleotideCount.fs Ver fichero

@@ -0,0 +1,26 @@
module NucleotideCount

let isValidNucleotide nucleotide =
nucleotide = 'A'
|| nucleotide = 'C'
|| nucleotide = 'G'
|| nucleotide = 'T'

let validInput (strand: string) =
String.collect (fun c -> if isValidNucleotide c then string (c) else "") strand = strand

let nucleotideCounts (strand: string): Option<Map<char, int>> =
if validInput strand then
let mutable counts =
Map.empty.Add('A', 0).Add('C', 0).Add('G', 0).Add('T', 0)

Seq.iter (fun c ->
if counts.ContainsKey c then
let current = counts.Item c
counts <- counts.Remove(c)
counts <- counts.Add(c, current + 1)
else
counts <- counts.Add(c, 1)) strand
Some(counts)
else
None

+ 21
- 0
exercism/fsharp/nucleotide-count/NucleotideCount.fsproj Ver fichero

@@ -0,0 +1,21 @@
<Project Sdk="Microsoft.NET.Sdk">

<PropertyGroup>
<TargetFramework>netcoreapp3.0</TargetFramework>

<IsPackable>false</IsPackable>
</PropertyGroup>

<ItemGroup>
<Compile Include="NucleotideCount.fs" />
<Compile Include="NucleotideCountTests.fs" />
</ItemGroup>

<ItemGroup>
<PackageReference Include="Microsoft.NET.Test.Sdk" Version="16.6.1" />
<PackageReference Include="xunit" Version="2.4.1" />
<PackageReference Include="xunit.runner.visualstudio" Version="2.4.2" />
<PackageReference Include="FsUnit.xUnit" Version="3.8.1" />
</ItemGroup>

</Project>

+ 63
- 0
exercism/fsharp/nucleotide-count/NucleotideCountTests.fs Ver fichero

@@ -0,0 +1,63 @@
// This file was auto-generated based on version 1.3.0 of the canonical data.

module NucleotideCountTests

open FsUnit.Xunit
open Xunit

open NucleotideCount

[<Fact>]
let ``Empty strand`` () =
let strand = ""
let expected =
[ ('A', 0);
('C', 0);
('G', 0);
('T', 0) ]
|> Map.ofList
|> Some
nucleotideCounts strand |> should equal expected

[<Fact>]
let ``Can count one nucleotide in single-character input`` () =
let strand = "G"
let expected =
[ ('A', 0);
('C', 0);
('G', 1);
('T', 0) ]
|> Map.ofList
|> Some
nucleotideCounts strand |> should equal expected

[<Fact>]
let ``Strand with repeated nucleotide`` () =
let strand = "GGGGGGG"
let expected =
[ ('A', 0);
('C', 0);
('G', 7);
('T', 0) ]
|> Map.ofList
|> Some
nucleotideCounts strand |> should equal expected

[<Fact>]
let ``Strand with multiple nucleotides`` () =
let strand = "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"
let expected =
[ ('A', 20);
('C', 12);
('G', 17);
('T', 21) ]
|> Map.ofList
|> Some
nucleotideCounts strand |> should equal expected

[<Fact>]
let ``Strand with invalid nucleotides`` () =
let strand = "AGXXACT"
let expected = None
nucleotideCounts strand |> should equal expected


+ 33
- 0
exercism/fsharp/nucleotide-count/README.md Ver fichero

@@ -0,0 +1,33 @@
# Nucleotide Count

Given a single stranded DNA string, compute how many times each nucleotide occurs in the string.

The genetic language of every living thing on the planet is DNA.
DNA is a large molecule that is built from an extremely long sequence of individual elements called nucleotides.
4 types exist in DNA and these differ only slightly and can be represented as the following symbols: 'A' for adenine, 'C' for cytosine, 'G' for guanine, and 'T' thymine.

Here is an analogy:
- twigs are to birds nests as
- nucleotides are to DNA as
- legos are to lego houses as
- words are to sentences as...

## Running the tests

To run the tests, run the command `dotnet test` from within the exercise directory.

## Autoformatting the code

F# source code can be formatted with the [Fantomas](https://github.com/fsprojects/fantomas) tool.

After installing it with `dotnet tool restore`, run `dotnet fantomas .` to format code within the current directory.

## Further information

For more detailed information about the F# track, including how to get help if
you're having trouble, please visit the exercism.io [F# language page](http://exercism.io/languages/fsharp/resources).

## Source

The Calculating DNA Nucleotides_problem at Rosalind [http://rosalind.info/problems/dna/](http://rosalind.info/problems/dna/)


Cargando…
Cancelar
Guardar