Another f# problem done

exercism/fsharp/nucleotide-count/NucleotideCount.fs

+module NucleotideCount
+
+let isValidNucleotide nucleotide =
+    nucleotide = 'A'
+    || nucleotide = 'C'
+    || nucleotide = 'G'
+    || nucleotide = 'T'
+
+let validInput (strand: string) =
+    String.collect (fun c -> if isValidNucleotide c then string (c) else "") strand = strand
+
+let nucleotideCounts (strand: string): Option<Map<char, int>> =
+    if validInput strand then
+        let mutable counts =
+            Map.empty.Add('A', 0).Add('C', 0).Add('G', 0).Add('T', 0)
+
+        Seq.iter (fun c ->
+            if counts.ContainsKey c then
+                let current = counts.Item c
+                counts <- counts.Remove(c)
+                counts <- counts.Add(c, current + 1)
+            else
+                counts <- counts.Add(c, 1)) strand
+        Some(counts)
+    else
+        None

exercism/fsharp/nucleotide-count/NucleotideCount.fsproj

+<Project Sdk="Microsoft.NET.Sdk">
+
+  <PropertyGroup>
+    <TargetFramework>netcoreapp3.0</TargetFramework>
+
+    <IsPackable>false</IsPackable>
+  </PropertyGroup>
+
+  <ItemGroup>
+    <Compile Include="NucleotideCount.fs" />
+    <Compile Include="NucleotideCountTests.fs" />
+  </ItemGroup>
+
+  <ItemGroup>
+    <PackageReference Include="Microsoft.NET.Test.Sdk" Version="16.6.1" />
+    <PackageReference Include="xunit" Version="2.4.1" />
+    <PackageReference Include="xunit.runner.visualstudio" Version="2.4.2" />
+    <PackageReference Include="FsUnit.xUnit" Version="3.8.1" />
+  </ItemGroup>
+
+</Project>

exercism/fsharp/nucleotide-count/NucleotideCountTests.fs

+// This file was auto-generated based on version 1.3.0 of the canonical data.
+
+module NucleotideCountTests
+
+open FsUnit.Xunit
+open Xunit
+
+open NucleotideCount
+
+[<Fact>]
+let ``Empty strand`` () =
+    let strand = ""
+    let expected = 
+        [ ('A', 0);
+          ('C', 0);
+          ('G', 0);
+          ('T', 0) ]
+        |> Map.ofList
+        |> Some
+    nucleotideCounts strand |> should equal expected
+
+[<Fact>]
+let ``Can count one nucleotide in single-character input`` () =
+    let strand = "G"
+    let expected = 
+        [ ('A', 0);
+          ('C', 0);
+          ('G', 1);
+          ('T', 0) ]
+        |> Map.ofList
+        |> Some
+    nucleotideCounts strand |> should equal expected
+
+[<Fact>]
+let ``Strand with repeated nucleotide`` () =
+    let strand = "GGGGGGG"
+    let expected = 
+        [ ('A', 0);
+          ('C', 0);
+          ('G', 7);
+          ('T', 0) ]
+        |> Map.ofList
+        |> Some
+    nucleotideCounts strand |> should equal expected
+
+[<Fact>]
+let ``Strand with multiple nucleotides`` () =
+    let strand = "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"
+    let expected = 
+        [ ('A', 20);
+          ('C', 12);
+          ('G', 17);
+          ('T', 21) ]
+        |> Map.ofList
+        |> Some
+    nucleotideCounts strand |> should equal expected
+
+[<Fact>]
+let ``Strand with invalid nucleotides`` () =
+    let strand = "AGXXACT"
+    let expected = None
+    nucleotideCounts strand |> should equal expected
+

exercism/fsharp/nucleotide-count/README.md

+# Nucleotide Count
+
+Given a single stranded DNA string, compute how many times each nucleotide occurs in the string.
+
+The genetic language of every living thing on the planet is DNA.
+DNA is a large molecule that is built from an extremely long sequence of individual elements called nucleotides.
+4 types exist in DNA and these differ only slightly and can be represented as the following symbols: 'A' for adenine, 'C' for cytosine, 'G' for guanine, and 'T' thymine.
+
+Here is an analogy:
+- twigs are to birds nests as
+- nucleotides are to DNA as
+- legos are to lego houses as
+- words are to sentences as...
+
+## Running the tests
+
+To run the tests, run the command `dotnet test` from within the exercise directory.
+
+## Autoformatting the code
+
+F# source code can be formatted with the [Fantomas](https://github.com/fsprojects/fantomas) tool.
+
+After installing it with `dotnet tool restore`, run `dotnet fantomas .` to format code within the current directory.
+
+## Further information
+
+For more detailed information about the F# track, including how to get help if
+you're having trouble, please visit the exercism.io [F# language page](http://exercism.io/languages/fsharp/resources).
+
+## Source
+
+The Calculating DNA Nucleotides_problem at Rosalind [http://rosalind.info/problems/dna/](http://rosalind.info/problems/dna/)
+